Stem-loop sequence dsi-mir-1002

AccessionMI0011738 (change log)
DescriptionDrosophila simulans miR-1002 stem-loop
Gene family MIPF0000909; mir-1002
Stem-loop
       a   uua       ua  u        ugg      aag     uugau 
5' ggaa uau   gaaauua  ua uuaaguag   auacaa   gcgau     a
   |||| |||   |||||||  || ||||||||   ||||||   |||||     u
3' ccuu aug   uuuuagu  au aauucauc   uauguu   cgcua     a
       -   ---       cg  c        cgg      --a     ugaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2L: 13506522-13506624 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-1002
dsi-mir-968chr2L: 13506683-13506780 [-]
dsi-mir-1002chr2L: 13506522-13506624 [-]
Database links

Mature sequence dsi-miR-1002-5p

Accession MIMAT0012439
Previous IDsdsi-miR-1002
Sequence

24 - 

uuaaguaguggauacaaaaggcga

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-1002-3p

Accession MIMAT0012440
Previous IDsdsi-miR-1002*
Sequence

64 - 

cgcauuguauggccuacuuaacu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).