Stem-loop sequence dsi-mir-991

AccessionMI0011733 (change log)
DescriptionDrosophila simulans miR-991 stem-loop
Gene family MIPF0000957; mir-991
Stem-loop
       aua     aauaucac     uu     c      c    a  u  a       uuauu 
5' gggu   ucaaa        ugcag  ucagg uuuucc aacu ca cu uuaauau     u
   ||||   |||||        |||||  ||||| |||||| |||| || || |||||||     u
3' ccua   aguuu        acguu  gguuu aaaagg uuga gu ga aauuaug     a
       --a     --------     uu     u      u    a  u  -       cugca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 15134391-15134508 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-991
dsi-mir-992chr2R: 15134519-15134598 [-]
dsi-mir-991chr2R: 15134391-15134508 [-]
dsi-mir-2498cchr2R: 15134038-15134093 [-]
dsi-mir-2498achr2R: 15133881-15133941 [-]
dsi-mir-2498bchr2R: 15133515-15133573 [-]
dsi-mir-313chr2R: 15132988-15133053 [-]
dsi-mir-312chr2R: 15132849-15132914 [-]
dsi-mir-311chr2R: 15132682-15132767 [-]
dsi-mir-310chr2R: 15132557-15132645 [-]
Database links

Mature sequence dsi-miR-991-5p

Accession MIMAT0012429
Previous IDsdsi-miR-991*
Sequence

36 - 

uucccaacuacaucuauuaauau

 - 58

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dsi-miR-991-3p

Accession MIMAT0012430
Previous IDsdsi-miR-991
Sequence

75 - 

uuaaaguugaaguuuggaaaau

 - 96

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).