Stem-loop sequence dsi-mir-1012

AccessionMI0011731 (change log)
DescriptionDrosophila simulans miR-1012 stem-loop
Gene family MIPF0001046; mir-1012
Stem-loop
   gccacuaauccaaaagaacg     u    -              gc 
5'                     guggg agaa cuuugauuaauauu  u
                       ||||| |||| ||||||||||||||  u
3'                     uaccc uuuu gaaacugauuauaa  g
   --cgguuuuaacuauuuaga     c    a              ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3R: 22517514-22517607 [-]
intergenic
Database links

Mature sequence dsi-miR-1012-5p

Accession MIMAT0012425
Previous IDsdsi-miR-1012
Sequence

21 - 

guggguagaacuuugauuaaua

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-1012-3p

Accession MIMAT0012426
Previous IDsdsi-miR-1012*
Sequence

56 - 

uuagucaaagauuuuccccauag

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).