Stem-loop sequence dps-mir-2576-1

AccessionMI0011727 (change log)
DescriptionDrosophila pseudoobscura miR-2576-1 stem-loop
Gene family MIPF0001066; mir-2576
Stem-loop
   c        - gu         --     -   c        u   -    acau   a    ca 
5'  ggcgaucg g  cucucgagu  gugga gag augggagu ggc ggac    gag guuc  c
    |||||||| |  |||||||||  ||||| ||| |||||||| ||| ||||    ||| ||||   
3'  cugcuagc c  gagagcucg  cgccu cuc uacucuca ccg ccug    cuc caag  c
   -        g ug         cc     a   -        c   a    ----   -    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
Unknown_group_319: 10719-10838 [+]
intergenic
Database links

Mature sequence dps-miR-2576

Accession MIMAT0012422
Sequence

15 - 

cucgaguguggagagcauggga

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).