Stem-loop sequence dps-mir-2569

AccessionMI0011717 (change log)
DescriptionDrosophila pseudoobscura miR-2569 stem-loop
Stem-loop
   -    --g  -cu      uc   g     g        ggauc    g 
5'  uguu   ga   ccagua  guu cucgg ucguuguu     uauu a
    ||||   ||   ||||||  ||| ||||| ||||||||     ||||  
3'  acaa   cu   ggucau  uaa gagcc agcaacaa     auga a
   a    aaa  cac      uu   g     a        -----    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group5: 2250946-2251036 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2569
dps-mir-2568b4_group5: 2251087-2251206 [-]
dps-mir-25694_group5: 2250946-2251036 [-]
Database links

Mature sequence dps-miR-2569-5p

Accession MIMAT0012406
Previous IDsdps-miR-2569
Sequence

15 - 

aucguugcucgggucguugu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2569-3p

Accession MIMAT0012407
Previous IDsdps-miR-2569*
Sequence

55 - 

caacgaaccgaggaauuuuac

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).