Stem-loop sequence dps-mir-2567c

AccessionMI0011713 (change log)
DescriptionDrosophila pseudoobscura miR-2567c stem-loop
Gene family MIPF0000934; mir-2567
Stem-loop
   -   accaaau        -u   a    ug    uu     a   uugc   u 
5'  gua       uucaaguu  cuu ccag  ugga  uguaa acg    guu u
    |||       ||||||||  ||| ||||  ||||  ||||| |||    |||  
3'  cgu       aaguucga  gaa gguc  accu  acguu ugc    caa u
   g   ccacuac        uu   c    ua    uu     a   ---u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group4: 3553417-3553521 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2567c
dps-mir-25104_group4: 3551345-3551451 [+]
dps-mir-2566a-14_group4: 3552319-3552402 [+]
dps-mir-2511-14_group4: 3552536-3552652 [+]
dps-mir-2567a4_group4: 3552872-3552956 [+]
dps-mir-2566a-24_group4: 3553033-3553118 [+]
dps-mir-2567c4_group4: 3553417-3553521 [+]
dps-mir-2566b4_group4: 3553900-3553982 [+]
dps-mir-2511-24_group4: 3554138-3554224 [+]
dps-mir-2567b4_group4: 3554452-3554536 [+]
Database links

Mature sequence dps-miR-2567c-5p

Accession MIMAT0012398
Previous IDsdps-miR-2567c*
Sequence

23 - 

accaguguggauuuguaaaacgu

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2567c-3p

Accession MIMAT0012399
Previous IDsdps-miR-2567c
Sequence

62 - 

uauugcauuuccaaucuggcaa

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).