Stem-loop sequence dps-mir-2564

AccessionMI0011708 (change log)
DescriptionDrosophila pseudoobscura miR-2564 stem-loop
Stem-loop
   ga    uauaaa     aaacaa   u  -             --    u       uu 
5'   aguu      accag      auu ug uguaaaugugaua  auug uuguaag  u
     ||||      |||||      ||| || |||||||||||||  |||| |||||||   
3'   ucga      ugguc      uaa au auauuugcauuau  uaac aauauuc  g
   -c    ----uc     ---gag   u  g             uc    u       cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group4: 1639565-1639673 [+]
intergenic
Database links

Mature sequence dps-miR-2564-5p

Accession MIMAT0012390
Previous IDsdps-miR-2564*
Sequence

31 - 

guaaaugugauaauuguuuguaa

 - 53

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2564-3p

Accession MIMAT0012391
Previous IDsdps-miR-2564
Sequence

65 - 

uaaucaaucuuauuacguuuauag

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).