Stem-loop sequence dps-mir-2560

AccessionMI0011704 (change log)
DescriptionDrosophila pseudoobscura miR-2560 stem-loop
Stem-loop
   -     -------------  a     uuca    -gcu                   guaa   c 
5'  gcaau             ac uugcu    gagg    cgcucaucguuauuugaua    ucg a
    |||||             || |||||    ||||    |||||||||||||||||||    |||  
3'  uguua             ug aacgg    cucc    gcggguaguaaugaacugu    agu c
   g     caauaacucaaac  g     --cc    auau                   auaa   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 4018595-4018711 [+]
intergenic
Database links

Mature sequence dps-miR-2560-5p

Accession MIMAT0012382
Previous IDsdps-miR-2560
Sequence

24 - 

ucgcucaucguuauuugauagu

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2560-3p

Accession MIMAT0012383
Previous IDsdps-miR-2560*
Sequence

62 - 

ugucaaguaaugaugggcguaua

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).