Stem-loop sequence dps-mir-2559

AccessionMI0011703 (change log)
DescriptionDrosophila pseudoobscura miR-2559 stem-loop
Stem-loop
      ug     a  agag   u u    uac    uuua      aaa  aa -   u 
5' cag  gcugg ca    gug g ggga   ugau    gagaaa   aa  c cau a
   |||  ||||| ||    ||| | ||||   ||||    ||||||   ||  | |||  
3' guc  uggcc gu    cac c cccu   acua    cucuuu   uu  g gug a
      cg     c  --ga   u -    uuu    --ca      -gc  cg a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 4962040-4962148 [-]
intergenic
Database links

Mature sequence dps-miR-2559-5p

Accession MIMAT0012380
Previous IDsdps-miR-2559*
Sequence

18 - 

gugugugggauacugauuuuagaga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2559-3p

Accession MIMAT0012381
Previous IDsdps-miR-2559
Sequence

75 - 

ucacaucauuuuccccucacagu

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).