Stem-loop sequence dps-mir-2507b

AccessionMI0011697 (change log)
DescriptionDrosophila pseudoobscura miR-2507b stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
   a       gaua  c   --   a  --    u      a  uc   uu       ucuc 
5'  gugcugu    ag uga  caa ca  uuua aggcaa aa  agu  caauauu    u
    |||||||    || |||  ||| ||  |||| |||||| ||  |||  |||||||    u
3'  cacgaua    uc gcu  guu gu  aaau uccguu uu  uca  guuauaa    u
   -       aaaa  u   cc   a  uu    c      c  uu   -c       uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 8680663-8680779 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2507b
dps-mir-25513: 8678482-8678601 [+]
dps-mir-25523: 8679230-8679342 [+]
dps-mir-3113: 8679717-8679827 [+]
dps-mir-92c3: 8679866-8679980 [+]
dps-mir-25533: 8680021-8680129 [+]
dps-mir-25063: 8680187-8680303 [+]
dps-mir-25543: 8680335-8680451 [+]
dps-mir-2507a3: 8680507-8680614 [+]
dps-mir-2507b3: 8680663-8680779 [+]
Database links

Mature sequence dps-miR-2507b-5p

Accession MIMAT0012370
Previous IDsdps-miR-2507b
Sequence

29 - 

uaggcaaaaaucaguuucaauau

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2507b-3p

Accession MIMAT0012371
Previous IDsdps-miR-2507b*
Sequence

66 - 

uauugcacuuuuucuugccucu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).