Stem-loop sequence dps-mir-2544

AccessionMI0011684 (change log)
DescriptionDrosophila pseudoobscura miR-2544 stem-loop
Stem-loop
   a     cuauacaaau   cu    c  u    gcu     c        cuu  uu 
5'  uuggu          ggu  auag uu ccug   cucgg ucuauaug   ug  u
    |||||          |||  |||| || ||||   ||||| ||||||||   ||   
3'  aacca          cca  uauu aa ggac   gaguc agauauau   au  a
   -     ----------   uu    a  u    aac     a        cau  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8378925-8379029 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2544
dps-mir-2543b-1XL_group1e: 8380575-8380690 [-]
dps-mir-2517-3XL_group1e: 8380430-8380532 [-]
dps-mir-2544XL_group1e: 8378925-8379029 [-]
dps-mir-2542-3XL_group1e: 8378579-8378663 [-]
dps-mir-2543b-2XL_group1e: 8378173-8378288 [-]
dps-mir-2517-2XL_group1e: 8378028-8378132 [-]
dps-mir-2524XL_group1e: 8377507-8377599 [-]
dps-mir-2542-2XL_group1e: 8376961-8377045 [-]
dps-mir-2524XL_group1e: 8376659-8376751 [-]
dps-mir-2543a-2XL_group1e: 8373978-8374093 [-]
dps-mir-2542-1XL_group1e: 8373614-8373698 [-]
Database links

Mature sequence dps-miR-2544-5p

Accession MIMAT0012348
Previous IDsdps-miR-2544*
Sequence

29 - 

uccuggcucucggcucuauaug

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2544-3p

Accession MIMAT0012349
Previous IDsdps-miR-2544
Sequence

69 - 

uauagaacugagcaacagguaa

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).