Stem-loop sequence dps-mir-2517-1

AccessionMI0011678 (change log)
DescriptionDrosophila pseudoobscura miR-2517-1 stem-loop
Gene family MIPF0000839; mir-2517
Stem-loop
   -ccgggucaaauggucca              -      a c     uauuau 
5'                   gaguuuucagaucc ucaaau c auaug      u
                     |||||||||||||| |||||| | |||||       
3'                   uucaaaaguuuagg gguuua g uauac      u
   guucacaagaauucacuu              u      - u     uuucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
Unknown_singleton_1920: 1593-1697 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2517-1
dps-mir-2543a-1Unknown_singleton_1920: 1437-1552 [+]
dps-mir-2517-1Unknown_singleton_1920: 1593-1697 [+]
Database links

Mature sequence dps-miR-2517-3p

Accession MIMAT0012343
Previous IDsdps-miR-2517a
Sequence

62 - 

uauugauuugguggauuugaaaa

 - 84

Get sequence
Evidence experimental; Illumina [1]

Minor miR* sequence dps-miR-2517a*

Accession MIMAT0012342
Sequence

23 - 

uucagauccucaaauaccauaug

 - 45

Get sequence
Evidence experimental;

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).