Stem-loop sequence dps-mir-2530

AccessionMI0011664 (change log)
DescriptionDrosophila pseudoobscura miR-2530 stem-loop
Stem-loop
   -------------------------gacua        a     cuggaaguuacagug 
5'                               agcucaua uauuu               g
                                 |||||||| |||||                
3'                               ucgagugu auaaa               g
   ugaacugaguuuuccgaaauuccgcaauug        -     ucgccgaaccuauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 11520725-11520818 [+]
intergenic
4_group4: 4563451-4563544 [-]
intergenic
Unknown_group_23: 63023-63116 [-]
intergenic
XL_group1a: 1742130-1742223 [-]
intergenic
Unknown_singleton_605: 715-808 [-]
intergenic
Database links

Mature sequence dps-miR-2530

Accession MIMAT0012319
Sequence

15 - 

uauuucuggaaguuacagugggc

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).