Stem-loop sequence dps-mir-2528-1

AccessionMI0011662 (change log)
DescriptionDrosophila pseudoobscura miR-2528-1 stem-loop
Gene family MIPF0001059; mir-2528
Stem-loop
       aa     cgua    -u   uuu    u   -   c     --u            u 
5' acgg  uuuua    uuca  ccg   uguc gua ucg gaagu   uggagucguuuu g
   ||||  |||||    ||||  |||   |||| ||| ||| |||||   ||||||||||||  
3' ugcc  agaau    aagu  ggu   auag cgu agu uuuua   accuuagcgaag u
       gg     --aa    uc   uuu    u   g   u     cgc            u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 24581194-24581311 [+]
intergenic
Database links

Mature sequence dps-miR-2528

Accession MIMAT0012306
Sequence

24 - 

uuuugucuguaucgcgaaguuugg

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).