Stem-loop sequence dps-mir-2525

AccessionMI0011658 (change log)
DescriptionDrosophila pseudoobscura miR-2525 stem-loop
Stem-loop
        aucca   a  uugcuu    c     c   u        ug   ---c   uu 
5' cgagu     uag ug      gcug ugcug cgc guugcugc  guu    ugc  c
   |||||     ||| ||      |||| ||||| ||| ||||||||  |||    |||  u
3' guuca     auc ac      cgac gcgac gcg caacggcg  caa    gcg  g
        acuuc   -  ------    a     a   u        gu   uuuu   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XR_group8: 4634865-4634975 [-]
intergenic
Database links

Mature sequence dps-miR-2525

Accession MIMAT0012313
Sequence

71 - 

cuggcggcaacugcgacagcga

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).