Stem-loop sequence dps-mir-2523

AccessionMI0011656 (change log)
DescriptionDrosophila pseudoobscura miR-2523 stem-loop
Stem-loop
   ----ucaaaugagaaugaaau   a      a          uu    c     uuuu 
5'                      gag uacuuu gguuauaugu  uuac uucgg    u
                        ||| |||||| ||||||||||  |||| |||||    u
3'                      cuc gugaga cuaguauaca  aaug aaguc    g
   cagcuuacaccgguucuuugu   c      g          uc    -     uaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8366995-8367108 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2523
dps-mir-2524XL_group1e: 8377507-8377599 [-]
dps-mir-2542-2XL_group1e: 8376961-8377045 [-]
dps-mir-2524XL_group1e: 8376659-8376751 [-]
dps-mir-2543a-2XL_group1e: 8373978-8374093 [-]
dps-mir-2542-1XL_group1e: 8373614-8373698 [-]
dps-mir-2541XL_group1e: 8367679-8367786 [-]
dps-mir-2540XL_group1e: 8367333-8367441 [-]
dps-mir-2523XL_group1e: 8366995-8367108 [-]
dps-mir-2539XL_group1e: 8366678-8366788 [-]
dps-mir-2522aXL_group1e: 8365900-8366011 [-]
dps-mir-2522bXL_group1e: 8363413-8363514 [-]
dps-mir-2538XL_group1e: 8363244-8363359 [-]
dps-mir-2521XL_group1e: 8362756-8362842 [-]
dps-mir-2520XL_group1e: 8362599-8362718 [-]
dps-mir-2537XL_group1e: 8362508-8362587 [-]
dps-mir-2536XL_group1e: 8362342-8362452 [-]
Database links

Mature sequence dps-miR-2523

Accession MIMAT0012311
Sequence

65 - 

aaguaacuacauaugaucgaga

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).