Stem-loop sequence dps-mir-2519

AccessionMI0011652 (change log)
DescriptionDrosophila pseudoobscura miR-2519 stem-loop
Stem-loop
   g   cu  c      ---auu   u   -   ug     uu         auaca    augaa 
5'  ugc  gg ggccgg      gaa aac gua  uggaa  gaaguugau     uucc     c
    |||  || ||||||      ||| ||| |||  |||||  |||||||||     ||||      
3'  acg  uc ccggcc      cuu uug cau  acuuu  cuuuaacua     aggg     a
   -   --  -      cuuguu   c   a   ua     uu         ----c    aguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8341045-8341162 [-]
intergenic
Database links

Mature sequence dps-miR-2519

Accession MIMAT0012307
Sequence

26 - 

guauguggaauugaaguugauau

 - 48

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).