Stem-loop sequence dps-mir-2528-2

AccessionMI0011651 (change log)
DescriptionDrosophila pseudoobscura miR-2528-2 stem-loop
Gene family MIPF0001059; mir-2528
Stem-loop
   -    aa     -c  auuuau   uuu    u   -   c   -  u            u 
5'  acgg  uuuua  gu      ccg   uguc gua ucg gaa gu uggagucguuuu g
    ||||  |||||  ||      |||   |||| ||| ||| ||| || ||||||||||||  
3'  ugcc  agaau  ca      ggu   auag cau agc uuu cg accuuagcgaag u
   u    gg     aa  --guuc   uuu    u   g   u   a  c            u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
Unknown_singleton_1587: 1510-1627 [+]
intergenic
Database links

Mature sequence dps-miR-2528

Accession MIMAT0012306
Sequence

24 - 

uuuugucuguaucgcgaaguuugg

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).