Stem-loop sequence dps-mir-2517-4

AccessionMI0011648 (change log)
DescriptionDrosophila pseudoobscura miR-2517-4 stem-loop
Gene family MIPF0000839; mir-2517
Stem-loop
        ---------g  aaau   cc             --cc      a c     -u   a 
5' gccgg          uc    ggu  agaguuuucagau    ucaaau c auaug  auu u
   |||||          ||    |||  |||||||||||||    |||||| | |||||  ||| u
3' ugguc          ag    uca  uuucaaaaguuua    gguuua g uauac  uaa u
        aunnnnnnca  -aau   cu             nngu      - u     uu   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dps-miR-2517b

Accession MIMAT0012304
Sequence

24 - 

uucagauccucaaauaccauaug

 - 46

Get sequence
Evidence experimental; Illumina [1]

Minor miR* sequence dps-miR-2517a*

Accession MIMAT0012342
Sequence

24 - 

uucagauccucaaauaccauaug

 - 46

Get sequence
Evidence experimental;

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).