Stem-loop sequence dps-mir-2513b

AccessionMI0011646 (change log)
DescriptionDrosophila pseudoobscura miR-2513b stem-loop
Gene family MIPF0000980; mir-2513
Stem-loop
      a           a            c  u     a      a  uuucaauuuuuc 
5' gua aggaccaacgu cuaccauguaaa ca cuuca accaua ua            a
   ||| ||||||||||| |||||||||||| || ||||| |||||| ||             
3' cau uccugguugca gaugguacauuu gu gaagu ugguau au            u
      c           c            c  u     c      c  uauuccuuauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
Unknown_group_64: 7644-7763 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2513b
dps-mir-2513aUnknown_group_64: 7644-7763 [-]
dps-mir-2513bUnknown_group_64: 7644-7763 [+]
Database links

Mature sequence dps-miR-2513b

Accession MIMAT0012302
Sequence

77 - 

uauggucugaaguugcuuuaca

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).