Stem-loop sequence dps-mir-2510

AccessionMI0011636 (change log)
DescriptionDrosophila pseudoobscura miR-2510 stem-loop
Stem-loop
   -  uu   ---a   -a        auu a        u            guau 
5'  gu  uga    uuc  cauucugc   g aaaagcaa ggauaauagaau    u
    ||  |||    |||  ||||||||   | |||||||| ||||||||||||     
3'  cg  gcu    agg  guagggcg   c uuuucguu cuuguuaucuua    u
   a  cu   gacg   gg        aau c        c            aacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group4: 3551345-3551451 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2510
dps-mir-25104_group4: 3551345-3551451 [+]
dps-mir-2566a-14_group4: 3552319-3552402 [+]
dps-mir-2511-14_group4: 3552536-3552652 [+]
dps-mir-2567a4_group4: 3552872-3552956 [+]
dps-mir-2566a-24_group4: 3553033-3553118 [+]
dps-mir-2567c4_group4: 3553417-3553521 [+]
dps-mir-2566b4_group4: 3553900-3553982 [+]
dps-mir-2511-24_group4: 3554138-3554224 [+]
dps-mir-2567b4_group4: 3554452-3554536 [+]
Database links

Mature sequence dps-miR-2510

Accession MIMAT0012295
Sequence

23 - 

ugaaaaagcaauggauaauaga

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).