Stem-loop sequence dps-mir-2502

AccessionMI0011627 (change log)
DescriptionDrosophila pseudoobscura miR-2502 stem-loop
Stem-loop
          caa  -gca          a           c a   a     aga   a 
5' gcugcaa   cg    ggcggcggca cggcggcagcg c gca cagcu   guu u
   |||||||   ||    |||||||||| ||||||||||| | ||| |||||   |||  
3' ugacguu   gc    ccgucgucgu gccgucgucgu g cgu gucga   cag a
          aag  aaac          c           a c   c     ---   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 16637948-16638059 [-]
intergenic
Database links

Mature sequence dps-miR-2502

Accession MIMAT0012286
Sequence

29 - 

gcggcagcgccagcaacagcu

 - 49

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).