Stem-loop sequence dps-mir-210b

AccessionMI0011625 (change log)
Previous IDsdps-mir-210-as
DescriptionDrosophila pseudoobscura miR-210b stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   u   ---   aaua   ccu    caa    c    -    ac        gucuu 
5'  gau   gcu    ugg   cuua   uagc gcug ucac  gcacaaga     a
    |||   |||    |||   ||||   |||| |||| ||||  ||||||||     a
3'  cua   cga    gcc   gaau   gucg cgac ggug  cguguucu     a
   a   aau   gcua   -au    aac    a    c    -a        aaucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group3a: 1970510-1970618 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-210b
dps-mir-210bXL_group3a: 1970510-1970618 [+]
dps-mir-210aXL_group3a: 1970510-1970603 [-]
dps-mir-969XL_group3a: 1977493-1977604 [-]
Database links

Mature sequence dps-miR-210b

Accession MIMAT0012283
Previous IDsdps-miR-210-as
Sequence

63 - 

uugugcaguggccagcagcugc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).