Stem-loop sequence dps-mir-3983

AccessionMI0011624 (change log)
Previous IDsdps-mir-263a-as
DescriptionDrosophila pseudoobscura miR-3983 stem-loop
Stem-loop
   -      -   caua    c    --     a       -  gua 
5'  gucccg cac    gaug cacu  aagag ucacggg uu   u
    |||||| |||    |||| ||||  ||||| ||||||| ||   u
3'  uagggc gug    uuac guga  uucuu agugccc aa   g
   g      c   ucaa    c    cc     a       c  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 7322805-7322892 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-3983
dps-mir-39834_group3: 7322805-7322892 [-]
dps-mir-263a4_group3: 7322804-7322895 [+]
Database links

Mature sequence dps-miR-3983

Accession MIMAT0012282
Previous IDsdps-miR-263a-as
Sequence

13 - 

agaugccacuaagagaucac

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).