Stem-loop sequence dps-mir-986

AccessionMI0011622 (change log)
DescriptionDrosophila pseudoobscura miR-986 stem-loop
Gene family MIPF0000860; mir-986
Stem-loop
   a   -          u  c            ga    --u  c   a 
5'  cug aaacaacccg cu gaauagcguugu  cuga   ga ugc u
    ||| |||||||||| || ||||||||||||  ||||   || |||  
3'  ggc uuuguugggu ga cuuaucgugacg  gacu   uu aug u
   -   g          u  c            gc    cuu  a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 2308620-2308711 [+]
intergenic
Database links

Mature sequence dps-miR-986-5p

Accession MIMAT0012279
Previous IDsdps-miR-986
Sequence

15 - 

ucucgaauagcguugugacuga

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-986-3p

Accession MIMAT0012280
Previous IDsdps-miR-986*
Sequence

56 - 

cucagcggcagugcuauuccag

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).