Stem-loop sequence dps-mir-969

AccessionMI0011620 (change log)
DescriptionDrosophila pseudoobscura miR-969 stem-loop
Gene family MIPF0000879; mir-969
Stem-loop
   a   -  ---------------    u     ug       c  caug        gagcgua 
5'  gga gc               cugu cuacg  cgaguuc ac    caaguuuu       u
    ||| ||               |||| |||||  ||||||| ||    ||||||||       a
3'  ccu cg               gacg ggugc  gcucgag ug    guucaaaa       u
   -   a  cgacgcuacuaaacc    u     gu       u  caca        accuaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group3a: 1977493-1977604 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-969
dps-mir-969XL_group3a: 1977493-1977604 [-]
dps-mir-210bXL_group3a: 1970510-1970618 [+]
dps-mir-210aXL_group3a: 1970510-1970603 [-]
Database links

Mature sequence dps-miR-969-5p

Accession MIMAT0012275
Previous IDsdps-miR-969*
Sequence

20 - 

gaguuccaccaugcaaguuuu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-969-3p

Accession MIMAT0012276
Previous IDsdps-miR-969
Sequence

60 - 

aacuugacacguugagcucgu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).