Stem-loop sequence dps-mir-1000

AccessionMI0011615 (change log)
DescriptionDrosophila pseudoobscura miR-1000 stem-loop
Gene family MIPF0000701; mir-1000
Stem-loop
          gc  u  a  u       u a        --      c 
5' ggcgcuu  ca ug ua uguccug c cagcagua  uuguaa u
   |||||||  || || || ||||||| | ||||||||  |||||| u
3' ccgcgag  gu ac au acggggc g gucgucau  gauauu a
          uu  u  a  u       u g        cc      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 21158172-21158262 [-]
intergenic
Database links

Mature sequence dps-miR-1000-5p

Accession MIMAT0012265
Previous IDsdps-miR-1000
Sequence

15 - 

auauuguccugucacagcagua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-1000-3p

Accession MIMAT0012266
Previous IDsdps-miR-1000*
Sequence

58 - 

cugcugggucggggcauuaaca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).