Stem-loop sequence dps-mir-994

AccessionMI0011602 (change log)
DescriptionDrosophila pseudoobscura miR-994 stem-loop
Gene family MIPF0001045; mir-994
Stem-loop
   -   aau     -uc            -           c     uuaacauaca 
5'  cug   uuaua   gaguuaucuaag gaaauaguagc gugau          a
    |||   |||||   |||||||||||| ||||||||||| |||||           
3'  gac   aaugu   cucgauagauuu cuuugucguug cacua          a
   c   --g     uuu            u           a     uacauuuccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 7233495-7233601 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-994
dps-mir-9942: 7233495-7233601 [-]
dps-mir-3182: 7233349-7233416 [-]
Database links

Mature sequence dps-miR-994-5p

Accession MIMAT0012239
Previous IDsdps-miR-994
Sequence

22 - 

uaaggaaauaguagccguga

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-994-3p

Accession MIMAT0012240
Previous IDsdps-miR-994*
Sequence

67 - 

cacaguugcuguuucuuuua

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).