Stem-loop sequence dps-mir-958

AccessionMI0011598 (change log)
DescriptionDrosophila pseudoobscura miR-958 stem-loop
Gene family MIPF0000912; mir-958
Stem-loop
       c     guau    c           c   cuua     u  uccau 
5' cgau ggugu    uugg aaguagaauag agg    ucaca gu     u
   |||| |||||    |||| ||||||||||| |||    ||||| ||      
3' guug ccaca    agcu uucaucuuauc ucu    agugu cg     c
       c     -aac    -           u   -uag     -  ccuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XR_group8: 344180-344279 [-]
intergenic
Database links

Mature sequence dps-miR-958-5p

Accession MIMAT0012231
Previous IDsdps-miR-958
Sequence

21 - 

aguagaauagcaggcuuaucaca

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-958-3p

Accession MIMAT0012232
Previous IDsdps-miR-958*
Sequence

63 - 

ugagauucuucuauucuacuuu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).