Stem-loop sequence dps-mir-971

AccessionMI0011595 (change log)
DescriptionDrosophila pseudoobscura miR-971 stem-loop
Gene family MIPF0000995; mir-971
Stem-loop
   -   -- - -   u            auu      g    a   u  uug 
5'  gga  c c cca cgcucgcuguaa   guaaug ccaa gcu uu   u
    |||  | | ||| ||||||||||||   |||||| |||| ||| ||    
3'  ccu  g g ggu gugagugacauu   cauugu gguu cga ga   u
   a   uu c a   -            cuu      -    -   c  ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group3a: 1391627-1391720 [-]
intergenic
Database links

Mature sequence dps-miR-971-5p

Accession MIMAT0012225
Previous IDsdps-miR-971*
Sequence

15 - 

gcuguaaauuguaauggccaaagc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-971-3p

Accession MIMAT0012226
Previous IDsdps-miR-971
Sequence

57 - 

uugguguuacuucuuacaguga

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).