Stem-loop sequence dps-mir-980

AccessionMI0011594 (change log)
DescriptionDrosophila pseudoobscura miR-980 stem-loop
Gene family MIPF0000890; mir-980
Stem-loop
     c       agaaacaaauuga         uc     u   u  u     ugacuugu 
5' gc acaaaag             augugaguc  ucaca ggc gg cuagc        u
   || |||||||             |||||||||  ||||| ||| || |||||         
3' cg uguuuuu             ugcauucgg  agugu ccg uc gaucg        u
     a       ------------g         ga     u   -  -     uuauaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 4097649-4097756 [-]
intergenic
Database links

Mature sequence dps-miR-980-5p

Accession MIMAT0012223
Previous IDsdps-miR-980*
Sequence

29 - 

agucucucacauggcuggucuagc

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-980-3p

Accession MIMAT0012224
Previous IDsdps-miR-980
Sequence

73 - 

uagcugccuugugaagggcuu

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).