Stem-loop sequence dps-mir-981

AccessionMI0011592 (change log)
DescriptionDrosophila pseudoobscura miR-981 stem-loop
Gene family MIPF0000710; mir-981
Stem-loop
   -       u aaau          ua          guua   a 
5'  uccacau g    cggguuucgu  acagcgggcu    uga u
    ||||||| |    ||||||||||  ||||||||||    ||| a
3'  aggugug c    guccaaagca  uguugcuuga    acu a
   g       u guac          gc          -aca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1a: 4258928-4259016 [-]
intergenic
Database links

Mature sequence dps-miR-981-5p

Accession MIMAT0012219
Previous IDsdps-miR-981*
Sequence

14 - 

cggguuucguuaacagcgggcu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-981-3p

Accession MIMAT0012220
Previous IDsdps-miR-981
Sequence

56 - 

uucguugucgacgaaaccugca

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).