Stem-loop sequence dps-mir-989

AccessionMI0011591 (change log)
DescriptionDrosophila pseudoobscura miR-989 stem-loop
Gene family MIPF0000885; mir-989
Stem-loop
   a   ug        gg       c     g        ---ua  -----          gaucu 
5'  cgu  cgggaaug  ccacuac ucgca ucacguga     uc     ggaaugcaau     a
    |||  ||||||||  ||||||| ||||| ||||||||     ||     ||||||||||      
3'  gcg  guccuuac  ggugaug agugu aguguacu     ag     cuuuguguua     c
   -   --        aa       c     -        ugaua  uuuuu          aauug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 2729300-2729419 [-]
intergenic
Database links

Mature sequence dps-miR-989

Accession MIMAT0012218
Sequence

90 - 

ugugaugugacguaguggaaca

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).