Stem-loop sequence dme-mir-2498

AccessionMI0011587 (change log)
DescriptionDrosophila melanogaster miR-2498 stem-loop
Literature search

1 open access papers mention dme-mir-2498
(1 sentences)

Stem-loop
      a    -ccauaaucuc  u      -    a   u uu     uau       u 
5' cac uuug           cu aaaaua guaa ggc g  augcu   uuuugug u
   ||| ||||           || |||||| |||| ||| |  |||||   ||||||| u
3' gug aaac           ga uuuuau cauu cug c  uacgg   aaaacau u
      -    cacauucaaaa  c      u    -   c cu     -uc       u 
Get sequence
Deep sequencing
147 reads, 29.4 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 20584709-20584820 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-2498
dme-mir-992chr2R: 20585314-20585405 [-]
dme-mir-991chr2R: 20585200-20585295 [-]
dme-mir-2498chr2R: 20584709-20584820 [-]
dme-mir-313chr2R: 20584190-20584260 [-]
dme-mir-312chr2R: 20584056-20584121 [-]
dme-mir-311chr2R: 20583877-20583960 [-]
dme-mir-310chr2R: 20583752-20583840 [-]
Database links

Mature sequence dme-miR-2498-5p

Accession MIMAT0012210
Previous IDsdme-miR-2498*
Sequence

29 - 

uaaaggcuguuaugcuuauuuuug

 - 52

Get sequence
Deep sequencing41 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence dme-miR-2498-3p

Accession MIMAT0012211
Previous IDsdme-miR-2498
Sequence

64 - 

aaacuggcauucccgucuuacuu

 - 86

Get sequence
Deep sequencing101 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).