Stem-loop sequence dme-mir-2490

AccessionMI0011579 (change log)
DescriptionDrosophila melanogaster miR-2490 stem-loop
Stem-loop
   ga       g           c   uu     cu  uc 
5'   gcgaguu aagcgauaaag agg  gcaaa  gc  u
     ||||||| ||||||||||| |||  |||||  ||   
3'   cgcucaa uucgcuauuuc uuc  cguuu  cg  c
   aa       a           a   -u     --  cu 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 23168825-23168899 [+]
antisense
FBtr0300704 ; CG12567-RF; intron 1
FBtr0113704 ; CG12567-RA; intron 1
FBtr0113705 ; CG12567-RC; intron 1
FBtr0300703 ; CG12567-RE; intron 1
FBtr0300702 ; CG12567-RD; intron 1
Database links

Mature sequence dme-miR-2490-5p

Accession MIMAT0012197
Previous IDsdme-miR-2490
Sequence

9 - 

ugaagcgauaaagcagguugcaa

 - 31

Get sequence
Deep sequencing17 reads, 8 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence dme-miR-2490-3p

Accession MIMAT0020911
Sequence

47 - 

ugcucuuacuuuaucgcuuaa

 - 67

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence not experimental

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).