Stem-loop sequence dme-mir-307b

AccessionMI0011577 (change log)
Previous IDsdme-mir-307-as
DescriptionDrosophila melanogaster miR-307b stem-loop
Gene family MIPF0000937; mir-307as
Literature search

2 open access papers mention dme-mir-307b
(9 sentences)

Stem-loop
   u    uc ug auacuc    c    a c          gga  u       gauaccau 
5'  aguu  g  g      uguc ugcu u gcucacucaa   gg ugugaug        a
    ||||  |  |      |||| |||| | ||||||||||   || |||||||         
3'  ucaa  c  c      acag acga a ugagugaguu   cc acacuac        u
   u    -u gu -guaaa    a    a c          gga  c       aauaaagc 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 9621234-9621353 [+]
antisense
FBtr0088501 ; Mmp2-RB; intron 3
Clustered miRNAs
< 10kb from dme-mir-307b
dme-mir-307bchr2R: 9621234-9621353 [+]
dme-mir-307achr2R: 9621251-9621338 [-]
Database links

Mature sequence dme-miR-307b-5p

Accession MIMAT0012194
Previous IDsdme-miR-307-as*
Sequence

32 - 

ucacucaaggagguugugaugg

 - 53

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence dme-miR-307b-3p

Accession MIMAT0012195
Previous IDsdme-miR-307-as
Sequence

73 - 

ucacacccagguugagugagu

 - 93

Get sequence
Deep sequencing28 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).