Stem-loop sequence bdi-MIR444a

AccessionMI0011558 (change log)
Previous IDsbdi-MIR444
DescriptionBrachypodium distachyon miR444a stem-loop
Gene family MIPF0000402; MIR444
Literature search

1 open access papers mention bdi-MIR444a
(3 sentences)

Stem-loop
   cac   uc   -  a            c        g   a   c ug    -   a 
5'    gcg  cga cu gaggcagcaacu cauaacuu cgg aag u  uugg aug u
      |||  ||| || |||||||||||| |||||||| ||| ||| |  |||| ||| g
3'    cgu  guu ga cuccgucguuga guauugaa gcc uuu a  aacc uac a
   ---   -c   c  a            c        -   a   u gu    g   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR444a

Accession MIMAT0012173
Previous IDsbdi-miR444
Sequence

90 - 

uugcugccucaagcuugcugc

 - 110

Get sequence
Evidence experimental; qRT-PCR [1], Illumina [2]

References

1
2
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).