Stem-loop sequence bta-mir-2284e

AccessionMI0011549 (change log)
DescriptionBos taurus miR-2284e stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284e
(32 sentences)

Stem-loop
        caa   c      a     c    ug 
5' gccaa   guu guucgg uuuuu caua  a
   |||||   ||| |||||| ||||| ||||   
3' cgguu   caa caaguc aaaag guau  g
        uua   a      c     c    ug 
Get sequence
Deep sequencing
336 reads, 4.55 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 61745932-61745995 [-]
antisense
ENSBTAT00000018239 ; ATG4A-201; intron 1
Database links

Mature sequence bta-miR-2284e

Accession MIMAT0012080
Sequence

7 - 

aaguucguucggauuuuucc

 - 26

Get sequence
Deep sequencing87 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).