Stem-loop sequence bta-mir-664a

AccessionMI0011547 (change log)
Previous IDsbta-mir-664
DescriptionBos taurus miR-664 stem-loop
Gene family MIPF0000300; mir-664
Literature search

3 open access papers mention bta-mir-664a
(3 sentences)

Stem-loop
      a   uaaaacac         u   ug         ac 
5' ggg cau        aggcugggg gug  uggauggag  u
   ||| |||        ||||||||| |||  |||||||||  g
3' ucc gua        uccgauccc cau  gcuuaucuc  u
      -   --uagacc         u   uu         au 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 39531384-39531465 [-]
sense
ENSBTAT00000060339 ; SNORA36-201; exon 1
ENSBTAT00000017339 ; DKC1-201; intron 8
Database links

Mature sequence bta-miR-664a

Accession MIMAT0012078
Previous IDsbta-miR-664
Sequence

15 - 

caggcugggguguguguggaug

 - 36

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).