Stem-loop sequence bta-mir-2484

AccessionMI0011546 (change log)
DescriptionBos taurus miR-2484 stem-loop
Literature search

2 open access papers mention bta-mir-2484
(2 sentences)

Stem-loop
       c   -a      ug             -a   aa 
5' uuau uga  aaugua  caggguuauuaua  uua  a
   |||| |||  ||||||  |||||||||||||  |||   
3' agua acu  uuacgu  guuucaguaguau  agu  a
       c   ag      ua             cg   gg 
Get sequence
Deep sequencing
392 reads, 1.52 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 20570714-20570789 [-]
sense
ENSBTAT00000059177 ; SNORD61-201; exon 1
ENSBTAT00000017696 ; RBMX-201; intron 2
Database links

Mature sequence bta-miR-2484

Accession MIMAT0012077
Sequence

42 - 

gagcuaugaugacuuugauugcau

 - 65

Get sequence
Deep sequencing392 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).