Stem-loop sequence bta-mir-2483

AccessionMI0011545 (change log)
DescriptionBos taurus miR-2483 stem-loop
Gene family MIPF0001532; mir-2483
Literature search

3 open access papers mention bta-mir-2483
(8 sentences)

Stem-loop
                cg       u    c      -ag u 
5' gagugaaaaguuc  ucaacca ccag uguuug   g g
   |||||||||||||  ||||||| |||| ||||||   | a
3' uucauuuuuuaag  aguuggu gguc acaaac   c u
                ag       u    u      aaa g 
Get sequence
Deep sequencing
555 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 9234274-9234353 [-]
intergenic
Database links

Mature sequence bta-miR-2483-5p

Accession MIMAT0012075
Previous IDsbta-miR-2483*
Sequence

14 - 

cgucaaccauccagcuguuuga

 - 35

Get sequence
Deep sequencing316 reads, 63 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence bta-miR-2483-3p

Accession MIMAT0012076
Previous IDsbta-miR-2483
Sequence

48 - 

aaacaucugguugguugagaga

 - 69

Get sequence
Deep sequencing239 reads, 49 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).