Stem-loop sequence bta-mir-2478

AccessionMI0011540 (change log)
DescriptionBos taurus miR-2478 stem-loop
Literature search

6 open access papers mention bta-mir-2478
(39 sentences)

Stem-loop
   ----------gu   gg     u    ---a     -   aga  a 
5'             ugg  gucgg ggug    gcaag cag   cu c
               |||  ||||| ||||    ||||| |||   ||  
3'             acc  caguc ucac    uguuc guu   ga a
   caacuguuaugu   -a     u    ccua     c   --g  u 
Get sequence
Deep sequencing
5213 reads, 25.3 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 28165967-28166043 [-]
intergenic
Database links

Mature sequence bta-miR-2478

Accession MIMAT0012070
Sequence

46 - 

guaucccacuucugacacca

 - 65

Get sequence
Deep sequencing5213 reads, 75 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).