Stem-loop sequence bta-mir-2284o

AccessionMI0011538 (change log)
DescriptionBos taurus miR-2284o stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284o
(32 sentences)

Stem-loop
   u  ---            gg     u       
5'  gg   gaaaguucguuc  gguuu ccauag 
    ||   ||||||||||||  ||||| ||||| c
3'  cc   uuuucaagcaag  cuaag gguaua 
   a  ggu            -a     u       
Get sequence
Deep sequencing
550 reads, 23.1 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 25596364-25596424 [+]
intergenic
Database links

Mature sequence bta-miR-2284o

Accession MIMAT0012068
Sequence

5 - 

aaaguucguucgggguuuuc

 - 24

Get sequence
Deep sequencing535 reads, 47 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).