Stem-loop sequence bta-mir-2469

AccessionMI0011529 (change log)
DescriptionBos taurus miR-2469 stem-loop
Literature search

1 open access papers mention bta-mir-2469
(2 sentences)

Stem-loop
       a --u       --cu    -cu     ccg 
5' gguu c   guagggc    gcgg   uccgc   u
   |||| |   |||||||    ||||   |||||    
3' ccga g   cauuccg    cgcc   aggcg   g
       a uac       ccac    acc     cuc 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 11455248-11455314 [-]
intergenic
Database links

Mature sequence bta-miR-2469

Accession MIMAT0012059
Sequence

3 - 

uuacuguagggccugcggcuu

 - 23

Get sequence
Deep sequencing23 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).