Stem-loop sequence bta-mir-2468

AccessionMI0011528 (change log)
DescriptionBos taurus miR-2468 stem-loop
Stem-loop
                             u   ucauc 
5' gauuggcauaggaacauggaagauug cag     a
   |||||||||||||||||||||||||| |||     u
3' cugaccguguccuuguaccuuuuaac guc     c
                             c   uuuau 
Get sequence
Deep sequencing
88 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 5727335-5727407 [+]
intergenic
Database links

Mature sequence bta-miR-2468

Accession MIMAT0012058
Sequence

8 - 

auaggaacauggaagauuguca

 - 29

Get sequence
Deep sequencing76 reads, 19 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).