Stem-loop sequence bta-mir-1777b

AccessionMI0011520 (change log)
DescriptionBos taurus miR-1777b stem-loop
Literature search

3 open access papers mention bta-mir-1777b
(3 sentences)

Stem-loop
      gc         -----    augg     g  ---    au 
5' cug  ucucucugu     ugcc    caccg cc   ggag  g
   |||  |||||||||     ||||    ||||| ||   ||||   
3' gac  ggagggacg     gcgg    guggc gg   ucuc  a
      -a         uuggg    -ggg     g  ggg    gg 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 63811144-63811223 [-]
sense
ENSBTAT00000061140 ; PDGFRB-201; intron 1
Database links

Mature sequence bta-miR-1777b

Accession MIMAT0012046
Sequence

46 - 

gggggcgguggggggcgggg

 - 65

Get sequence
Deep sequencing11 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).