Stem-loop sequence bta-mir-339b

AccessionMI0011513 (change log)
DescriptionBos taurus miR-339b stem-loop
Literature search

5 open access papers mention bta-mir-339b
(5 sentences)

Stem-loop
       ug    c      -     gg   g 
5' uccc  uccu caggag cucca  ucu g
   ||||  |||| |||||| |||||  ||| g
3' aggg  agga gucuuu ggggu  ggg g
       --    c      a     gu   u 
Get sequence
Deep sequencing
14736 reads, 227 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 18457361-18457418 [-]
sense
ENSBTAT00000010081 ; MYO1F-201; intron 1
Database links

Mature sequence bta-miR-339b

Accession MIMAT0012038
Sequence

1 - 

ucccuguccuccaggagcuc

 - 20

Get sequence
Deep sequencing14733 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).