Stem-loop sequence bta-mir-1777a

AccessionMI0011508 (change log)
DescriptionBos taurus miR-1777a stem-loop
Literature search

2 open access papers mention bta-mir-1777a
(2 sentences)

Stem-loop
     -a      --   ga  gg    gg g      g   c 
5' gc  uggggu  ucc  gu  gggc  u gggggc ggu u
   ||  ||||||  |||  ||  ||||  | |||||| |||  
3' ug  gccucg  ggg  cg  cccg  g ucuccg ccg g
     gg      cu   ac  -a    -- g      g   a 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 107617597-107617672 [-]
sense
ENSBTAT00000007502 ; NSG1-201; intron 2
Database links

Mature sequence bta-miR-1777a

Accession MIMAT0012032
Sequence

16 - 

ugggggcgguggggggcggg

 - 35

Get sequence
Deep sequencing26 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).