Stem-loop sequence bta-mir-2448

AccessionMI0011502 (change log)
DescriptionBos taurus miR-2448 stem-loop
Literature search

2 open access papers mention bta-mir-2448
(2 sentences)

Stem-loop
         ug     a   c   a     -   -      
5' ugcacc  cggau caa caa cacgg uug gagaa 
   ||||||  ||||| ||| ||| ||||| ||| |||| u
3' augugg  gccua guu guu guguc aac cuuua 
         gu     g   a   g     u   a      
Get sequence
Deep sequencing
142 reads, 0 reads per million, 37 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 116014595-116014667 [-]
intergenic
Database links

Mature sequence bta-miR-2448-5p

Accession MIMAT0012025
Previous IDsbta-miR-2448*
Sequence

6 - 

cugcggauacaaccaaacacgg

 - 27

Get sequence
Deep sequencing41 reads, 27 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence bta-miR-2448-3p

Accession MIMAT0012026
Previous IDsbta-miR-2448
Sequence

49 - 

gugguugauuggauccgugggu

 - 70

Get sequence
Deep sequencing101 reads, 22 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).