Stem-loop sequence bta-mir-2446

AccessionMI0011500 (change log)
DescriptionBos taurus miR-2446 stem-loop
Literature search

2 open access papers mention bta-mir-2446
(2 sentences)

Stem-loop
       cu                c  gc     gaa 
5' gcua  aaaauauauuugaaau gg  cuuuu   a
   ||||  |||||||||||||||| ||  |||||    
3' cgau  uuuuauaugaacuuua cc  gaaaa   g
       ac                a  -a     gua 
Get sequence
Deep sequencing
125 reads, 0 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 100390755-100390825 [-]
intergenic
Database links

Mature sequence bta-miR-2446

Accession MIMAT0012023
Sequence

6 - 

uaaaauauauuugaaaucgggcc

 - 28

Get sequence
Deep sequencing125 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).